To validate the potential role of mutL as a genetic switch experimentally, through allele conversion, we converted mutL between the wild-type and 6bpΔmutL alleles using gene replacement techniques and examined changes of bacterial mutability after the manipulations. Here, we report our findings and discuss the significance of conversion between mutL and 6bpΔmutL in see more bacterial adaptation at the population level. The bacterial strains used in the study are listed in Table

1 and were cultured as described previously (Gong et al., 2007). M9 minimal medium, supplemented with proline (100 μg mL−1), tyrosine (100 μg mL−1), leucine (100 μg mL−1), lysine (100 μg mL−1), methionine (100 μg mL−1) or streptomycin (100 μg mL−1), was used for transduction and conjugation experiments. The three-dimensional structure of the mutant MutL was predicted via the swiss model program (http://swissmodel.expasy.org//SWISS-MODEL.html)

and then submitted to the vector alignment search tool (vast) in the NCBI Entrez system (http://www.ncbi.nlm.nih.gov/Structure/VAST/vast.shtml) for structure comparison. The structure of wild-type MutL was obtained from the molecular modeling database (MMDB) of the Entrez system (http://www.ncbi.nlm.nih.gov/Structure/MMDB/mmdb.shtml). The resulting protein database files were visualized by cn3d (version 4.1). Wild-type or defective mutL was PCR-amplified from S. typhimurium LT7 strains with primers F1, CGGAATTCCGAACAGCGAAATGGCAAAC (EcoRI site underlined), and R1, GGATCCGCGGGTCAATCTCCAGATACAG

Epigenetic inhibitor libraries (BamHI site underlined). PCR products were purified from agarose gels with QIAquick gel extraction kits (Qiagen) and an A-tailing nucleotide was added with Taq DNA polymerase (New England Biolabs) before cloning into pGEM-T (Promega) and introduction into chemically competent E. coli DH5α cells. Wild-type or defective mutL gene fragments were subcloned into EcoRI- and BamHI-digested pHSG415, which is a temperature-sensitive plasmid used for allele replacement via homologous recombination (White et al., 1999). Recombinant pHSG415 plasmids were first amplified in E. coli DH5α cells; after purification, these plasmids were transferred into S. typhimurium Teicoplanin LT7 strains by transformation. The allelic-exchange experiments were carried out as described by White et al. (1999). PCR was used to screen colonies for bacterial cells bearing successful allele replacements. PCR products amplified with primers F2 (ATATCGACATCGAGCGTGGCGGCG) and R2 (GCTTTCGAGTCGTCAAGCGAGGCG) were resolved by agarose gel electrophoresis. The primer pair GK A1 (GGAATTCAACAGCGAAATGGCAAACT, EcoRI site underlined) and GK A2 (GCTTACAGAAATCTCCTTAATTCGC) was used to amplify a segment upstream of mutL, and the primer pair GK B1 (AGGAGATTTCTGTAAGCAAGGCGAG) and GK B2 (CGGATCCCAACGCCTCCCATCCAAG, BamHI site underlined) was used to amplify a segment downstream of mutL.

To validate the potential role of mutL as a genetic switch experimentally, through allele conversion, we converted mutL between the wild-type and 6bpΔmutL alleles using gene replacement techniques and examined changes of bacterial mutability after the manipulations. Here, we report our findings and discuss the significance of conversion between mutL and 6bpΔmutL in PD 332991 bacterial adaptation at the population level. The bacterial strains used in the study are listed in Table

1 and were cultured as described previously (Gong et al., 2007). M9 minimal medium, supplemented with proline (100 μg mL−1), tyrosine (100 μg mL−1), leucine (100 μg mL−1), lysine (100 μg mL−1), methionine (100 μg mL−1) or streptomycin (100 μg mL−1), was used for transduction and conjugation experiments. The three-dimensional structure of the mutant MutL was predicted via the swiss model program (http://swissmodel.expasy.org//SWISS-MODEL.html)

and then submitted to the vector alignment search tool (vast) in the NCBI Entrez system (http://www.ncbi.nlm.nih.gov/Structure/VAST/vast.shtml) for structure comparison. The structure of wild-type MutL was obtained from the molecular modeling database (MMDB) of the Entrez system (http://www.ncbi.nlm.nih.gov/Structure/MMDB/mmdb.shtml). The resulting protein database files were visualized by cn3d (version 4.1). Wild-type or defective mutL was PCR-amplified from S. typhimurium LT7 strains with primers F1, CGGAATTCCGAACAGCGAAATGGCAAAC (EcoRI site underlined), and R1, GGATCCGCGGGTCAATCTCCAGATACAG

Selleckchem INCB024360 (BamHI site underlined). PCR products were purified from agarose gels with QIAquick gel extraction kits (Qiagen) and an A-tailing nucleotide was added with Taq DNA polymerase (New England Biolabs) before cloning into pGEM-T (Promega) and introduction into chemically competent E. coli DH5α cells. Wild-type or defective mutL gene fragments were subcloned into EcoRI- and BamHI-digested pHSG415, which is a temperature-sensitive plasmid used for allele replacement via homologous recombination (White et al., 1999). Recombinant pHSG415 plasmids were first amplified in E. coli DH5α cells; after purification, these plasmids were transferred into S. typhimurium Niclosamide LT7 strains by transformation. The allelic-exchange experiments were carried out as described by White et al. (1999). PCR was used to screen colonies for bacterial cells bearing successful allele replacements. PCR products amplified with primers F2 (ATATCGACATCGAGCGTGGCGGCG) and R2 (GCTTTCGAGTCGTCAAGCGAGGCG) were resolved by agarose gel electrophoresis. The primer pair GK A1 (GGAATTCAACAGCGAAATGGCAAACT, EcoRI site underlined) and GK A2 (GCTTACAGAAATCTCCTTAATTCGC) was used to amplify a segment upstream of mutL, and the primer pair GK B1 (AGGAGATTTCTGTAAGCAAGGCGAG) and GK B2 (CGGATCCCAACGCCTCCCATCCAAG, BamHI site underlined) was used to amplify a segment downstream of mutL.

First, direct isolation and analysis of the end of the linear chromosome with its covalently attached terminal protein by biochemical means is definitive (Lin et al., 1993; Goshi et al., 2002). Secondly, an analysis of the gene topology by pulsed-field gel electrophoresis (PFGE) is highly suggestive (Rednenbach et al., 2000). Finally, identification of genes associated with chromosome linearity, such as tpg (gene encoding the terminal protein that is covalently linked to the end of the linear chromosome), tap (gene encoding a telomere-associated protein that seems to be essential to linear chromosome replication

and is usually closely linked with tpg on the chromosome) and ttr (gene encoding a protein selleckchem that is present very close to

ends of most linear chromosomes and seems to be involved in linear genome mobilization), implies linearity is present or was present at some point in the past (Goshi et al., 2002; Huang et al., 2007; Suzuki et al., 2008; Kirby & Chen, 2011). However, the absence of homologues of one or all of the tpg, tap and ttr trio does not confirm circularity because there is significant diversity in the terminal I-BET-762 research buy replication mechanism of linear chromosomes and plasmids of Actinomycetales (Huang et al., 2007; Suzuki et al., 2008). The problems of defining linearity other than by definitive biochemical means, which is laborious, can be illustrated in a number of ways. Using PFGE, Saccharopolyspora erythraea NRRL 2338 was suggested Casein kinase 1 to be linear based on analysis of the absence and presence of chromosome bands before and after proteinase

K treatment (Reeves et al., 1998). However, by chromosome sequencing, Oliynyk et al. (2007) indicated that the chromosome of this species is circular. Analysis at the gene level of the chromosome sequence does not identify any homologues of the tpg, tap and ttr trio or the presence of terminal repeats, which supports the latter conclusion. Notwithstanding the missed restriction sites pinpointed by the chromosome sequencing, the entry of the 8 Mb chromosome into the PFGE gel after proteinase K digestion, and the failure of the untreated chromosome to enter the gel under identical circumstances, supports directly the presence of bound terminal protein at the ends of a linear chromosome. Furthermore, Oliynyk et al. (2007) provide indirect evidence to support circularity, for example on the basis of the detection by gel electrophoresis of a fragment overlapping both proposed termini of the linear chromosome. The question remains somewhat open, but perhaps biased towards circularity. In the case of other Actinomycetales chromosome sequences, there is even less evidence to support circularity.