To validate the potential role of mutL as a genetic switch experimentally, through allele conversion, we converted mutL between the wild-type and 6bpΔmutL alleles using gene replacement techniques and examined changes of bacterial mutability after the manipulations. Here, we report our findings and discuss the significance of conversion between mutL and 6bpΔmutL in PD 332991 bacterial adaptation at the population level. The bacterial strains used in the study are listed in Table

1 and were cultured as described previously (Gong et al., 2007). M9 minimal medium, supplemented with proline (100 μg mL−1), tyrosine (100 μg mL−1), leucine (100 μg mL−1), lysine (100 μg mL−1), methionine (100 μg mL−1) or streptomycin (100 μg mL−1), was used for transduction and conjugation experiments. The three-dimensional structure of the mutant MutL was predicted via the swiss model program (http://swissmodel.expasy.org//SWISS-MODEL.html)

and then submitted to the vector alignment search tool (vast) in the NCBI Entrez system (http://www.ncbi.nlm.nih.gov/Structure/VAST/vast.shtml) for structure comparison. The structure of wild-type MutL was obtained from the molecular modeling database (MMDB) of the Entrez system (http://www.ncbi.nlm.nih.gov/Structure/MMDB/mmdb.shtml). The resulting protein database files were visualized by cn3d (version 4.1). Wild-type or defective mutL was PCR-amplified from S. typhimurium LT7 strains with primers F1, CGGAATTCCGAACAGCGAAATGGCAAAC (EcoRI site underlined), and R1, GGATCCGCGGGTCAATCTCCAGATACAG

Selleckchem INCB024360 (BamHI site underlined). PCR products were purified from agarose gels with QIAquick gel extraction kits (Qiagen) and an A-tailing nucleotide was added with Taq DNA polymerase (New England Biolabs) before cloning into pGEM-T (Promega) and introduction into chemically competent E. coli DH5α cells. Wild-type or defective mutL gene fragments were subcloned into EcoRI- and BamHI-digested pHSG415, which is a temperature-sensitive plasmid used for allele replacement via homologous recombination (White et al., 1999). Recombinant pHSG415 plasmids were first amplified in E. coli DH5α cells; after purification, these plasmids were transferred into S. typhimurium Niclosamide LT7 strains by transformation. The allelic-exchange experiments were carried out as described by White et al. (1999). PCR was used to screen colonies for bacterial cells bearing successful allele replacements. PCR products amplified with primers F2 (ATATCGACATCGAGCGTGGCGGCG) and R2 (GCTTTCGAGTCGTCAAGCGAGGCG) were resolved by agarose gel electrophoresis. The primer pair GK A1 (GGAATTCAACAGCGAAATGGCAAACT, EcoRI site underlined) and GK A2 (GCTTACAGAAATCTCCTTAATTCGC) was used to amplify a segment upstream of mutL, and the primer pair GK B1 (AGGAGATTTCTGTAAGCAAGGCGAG) and GK B2 (CGGATCCCAACGCCTCCCATCCAAG, BamHI site underlined) was used to amplify a segment downstream of mutL.