Inhibition of histone demethylase JMJD1C
attenuates cardiac hypertrophy and fibrosis
induced by angiotensin II
Shenqian Zhang, Ying Lu & Chenyang Jiang
To cite this article: Shenqian Zhang, Ying Lu & Chenyang Jiang (2020): Inhibition of histone
demethylase JMJD1C attenuates cardiac hypertrophy and fibrosis induced by angiotensin II,
Journal of Receptors and Signal Transduction, DOI: 10.1080/10799893.2020.1734819
To link to this article: https://doi.org/10.1080/10799893.2020.1734819
Published online: 03 Mar 2020.
Submit your article to this journal
View related articles
View Crossmark data
RESEARCH ARTICLE
Inhibition of histone demethylase JMJD1C attenuates cardiac hypertrophy and
fibrosis induced by angiotensin II
Shenqian Zhanga,b
, Ying Lub and Chenyang Jianga
Department of Cardiology, Sir Run Run Shaw Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang, China;
Electrocardiogram Room of Department of Functional Examination, Tongde Hospital of Zhejiang Province, Hangzhou, Zhejiang, China
ABSTRACT
Pathological cardiac hypertrophy is a major risk factor for cardiovascular morbidity and mortality.
Histone demethylases (KDMs) are emerging regulators of transcriptional reprograming in cancer, how￾ever, their potential role in abnormal heart growth and fibrosis remains largely unknown. The aim of
this current study was to examine the role of JMJD1C, an H3K9me2 specific demethylase, in angioten￾sin II (Ang II) induced cardiac hypertrophy and fibrosis. In this study, we observed that Ang II could
increase the expression of JMJD1C detected by Western blot and RT-qPCR in vitro and in vivo.
Immunofluorescence staining showed that the treatment of Ang II could increase cardiomyocyte size.
RT-qPCR results have shown that Ang II could increase the expression of cell hypertrophic and fibrotic
markers in H9c2 cells. Whereas, inhibition of JMJD1C by shRNA and JIB-04, a small molecule histone
demethylase inhibitor, significantly reduced Ang II-induced cell hypertrophy, and hypertrophic and
fibrotic marker overexpression. Furthermore, cardiomyocyte JMJD1C knockdown decreased Tissue
Inhibitor of Metalloproteinases 1 (TIMP1) transcription with pro-fibrotic activity. In conclusion, JMJD1C
plays an important role in Ang II-induced cardiac hypertrophy and fibrosis by activating TIMP1 tran￾scription, targeting of JMJD1C may be an effective strategy for the treatment of Ang II-associated car￾diac diseases.
ARTICLE HISTORY
Received 26 August 2019
Revised 18 February 2020
Accepted 20 February 2020
KEYWORDS
JMJD1C; angiotensin II;
cardiac hypertrophy;
fibrosis; TIMP1;
epigenetic regulation
Introduction
Cardiovascular diseases (CVDs) present the leading causes of
death in the world. Cardiac hypertrophy plays a key role in
the pathological development of CVDs [1]. Cardiac hyper￾trophy is a major adaptive response of the heart that occurs
in various CVDs, when the heart responds to a variety of
extrinsic and intrinsic stimuli, including the activation of the
renin–angiotensin system, hypertension, pressure overload,
and myocardial infarction [2]. Although the hypertrophic
response can maintain normal cardiac function for a certain
time, prolonged cardiac hypertrophy becomes parlous,
resulting in cardiac dysfunction and heart failure (HF) [2].
Identifying the molecular mechanisms and potential targets
treating cardiac hypertrophy is thus vital to the field of car￾diovascular biology and may lead to new strategies for the
prevention or treatment of CVDs.
A hallmark of pathological cardiac hypertrophy and fibro￾sis is the re-expression of fetal genes [2]. Epigenetic modifi￾cations are emerging regulators of this transcriptional
reprograming [3–5]. Histone methylation is a conserved
posttranslational modification, and regulates a multiple of
genomic functions, including gene transcription [6]. Di- and
tri-methylation of histone 3 lysine 9 (H3K9me2 and H3K9me3)
are normally associated with transcriptional repressing and
are silenced in hypertrophic and failing hearts in mouse and
humans [7–9]. Histone methylation is dynamically controlled
by lysine methyltransferases (KMTs) and lysine demethylases
(KDMs). Zhang et al. reported that the H3K9me3 demethylase
KDM4A/JMJD2A promoted pressure overload-induced LVH
associated with activation of fetal genes re-expression [8].
Thienpont et al. reported that the H3K9me2 di-methyltransfer￾ase EHMT1/2 protected mice against pressure overload￾induced LVH associated with activation of fetal genes
re-expression [9]. Zhang et al. reported that the H3K9me2
demethylase KDM3A/JMJD1A promoted pressure overload￾induced LVH associated with the activation of fetal genes
re-expression [7]. Importantly, besides the H3K9me2/me1
demethylases JMJD1A, JMJD1C was also upregulated and
positively associated with heart diseases [7,10,11]. However,
its role in pathological heart diseases remains unknown.
Here, we indicated that Ang II induced JMJD1C expression
in vitro and in vivo. Inhibition of JMJD1C by genetic silence
and small molecular inhibitor attenuated Ang II-induced car￾diac hypertrophy and fibrosis in H9c2 cells.
Materials and methods
Materials and antibodies
Ang II was purchased from Sigma-Aldrich (St. Louis, MO,
USA). JIB-04 was obtained from MCE (MedChemExpress,
CONTACT Chenyang Jiang [email protected] Department of cardiology, Sir Run Run Shaw Hospital, Zhejiang University School of Medicine,
No.3 East Qingchun Road, Hangzhou 310016, Zhejiang Province, China

2020 Informa UK Limited, trading as Taylor & Francis Group
JOURNAL OF RECEPTORS AND SIGNAL TRANSDUCTION

https://doi.org/10.1080/10799893.2020.1734819

Shanghai, China). FITC-Phalloidin was purchased from Enzo
(New York, NY, USA). The compounds were dissolved in
dimethyl sulphoxide (DMSO) for in vitro experiments. The
antibodies for JMJD1C (ab106457) and TIMP1 (ab61224) were
purchased from Abcam (Cambridge. UK) and GAPDH
(sc25778) was purchased from Santa Cruz Biotech
(Dallas, TX).
Cell culture
The immortalized rat cardiomyocyte cell line H9c2 was pur￾chased from the American Type Culture Collection (ATCC,
Manassas, VA, USA) and cultured in DMEM/F12 supple￾mented with 10% fetal bovine serum, 100 U/ml penicillin and
100 U/ml streptomycin at 37
C in a humidified 5%
CO2 atmosphere.
Animal experiments
All animal care and experimental procedures complied with
the ‘The Detailed Rules and Regulations of Medical Animal
Experiments Administration and Implementation’ (Order no.
1998-55, Ministry of Public Health, China), and ‘Ordinance in
Experimental Animal Management’ (Order no. 1998-02,
Ministry of Science and Technology, China) and were
approved by the Zhejiang University School of Medicine
Animal Policy and Welfare Committee.
Male C57BL/6 mice (n ¼ 12) weighing 18–22 g aged
4 weeks were obtained from the Animal Center of Zhejiang
University School of Medicine (Hangzhou, China). Animals
were housed with a 12:12 h light–dark cycle at room tem￾perature, fed a standard rodent diet, and free accessed to
water. All mice were randomly divided into two groups with
six mice in each group: (i) vehicle control mice (vehicle
group); (ii) Ang II-induced cardiac hypertrophy mice that
received Ang II (Ang II group). Cardiac hypertrophy was
induced in 6-week-old C57BL/6 mice by a single subcutane￾ous injection of Ang II (0.5 mg/kg/2 days for 2 weeks) in phos￾phate buffer (pH 7.2), as described previously [12]. At the
end point, the mice were killed and the heart tissues were
snap-frozen in liquid nitrogen for gene and protein expres￾sion analysis.
Establishment of stable JMJD1C-knockdown H9c2
cell lines
JMJD1C special shRNA plasmids were generated by inserting
Rat JMJD1C specific targeting sequences 50
-GGAAATTAAAG
AAGATGAA-30 into pll3.7puro vector plasmid. All plasmids
were transfected into different cell lines using PolyJet trans￾fection reagent (SignaGen Laboratories, Ljamsville, MD, USA)
following the manufacturer’s instructions. 293T packaging
cells were transfected with lentivirus constructs. Viral super￾natants were collected during the 48–96-h period after trans￾fection and centrifuged at 2000 rpm for 30 min to remove
contaminating packaging cells. H9c2 were infected with the
viral supernatant in the presence of 10 lg/ml of polybrene
(Sigma-Aldrich). Puromycin (1 lg/ml) was added to select
stable JMJD1C-knockdown cell lines. The knockdown effi￾ciency was confirmed by Western blot and RT-qPCR analysis.
Immunofluorescence staining
Control and shJMJD1C H9c2 were cultured on coverslips
overnight and then treated with Ang II (1 lM) for 24 h. The
coverslips were removed from the 6-well plates, washed with
PBS, fixed in a 4% paraformaldehyde solution for 10 min, per￾meabilized with 0.1% (v/v) Triton X-100 for 5 min, and then
blocked with 5% bovine serum albumin (BSA) for 0.5 h at
room temperature. The cells were incubated with FITC￾Phalloidin (5 lg/ml) for 1 h. Coverslips were mounted with
antifading mounting media (Invitrogen, Carlsbad, CA, USA),
and images were captured at the same magnification (960)
on a FV10i confocal microscope and processed by FV10i soft￾ware (Olympus, Tokyo, Japan).
Real-time quantitative PCR
Cells or heart tissues (30–40 mg) were homogenized in
TRIZOL (Invitrogen) for isolation of total RNA according to
the manufacturer’s protocol. A 2 lg of total RNA was used
for reverse transcription with one-step RT-PCR Master Mix kit
(TOYOBO) to generate cDNA. The cDNA is used in SYBR￾based real-time RT-qPCR. The sequences of the primers for
each gene detected are listed in Table 1. The amount of
each gene was determined and normalized to the amount
of b-actin.
Western immunoblot analysis
Cells or heart tissues (30–50 mg) were homogenized in RIPA
buffer. A 10–20 lg of lysates was separated by 8% SDS-PAGE
and electrotransferred to a PVDF membrane. Each membrane
was pre-incubated for 1 h at room temperature in Tris￾buffered saline, pH 7.6, containing 0.05% Tween 20 and 5%
nonfat milk. Each PVDF membrane was incubated with
JMJD1C (1:1000), TIMP1 (1:1000), or GAPDH (1;2000) antibod￾ies. Immunoreactive bands were then detected by incubating
with a secondary antibody conjugated with horseradish per￾oxidase and visualizing using enhanced chemiluminescence
reagents (Bio-Rad, Hercules, CA, USA). The amounts of the
proteins were analyzed using Image J analysis software
Table 1. Sequences of the primers for this study.
Source Gene Sequence 50
–30 (forward) Sequence 50
–30 (reverse)
Mouse JMJD1C CACCCGCACCATGATCGTTAT CTTCGCCGTGATGTAATGCC
b-Actin CCGTGAAAAGATGACCCAGA TACGACCAGAGGCATACAG
Rat JMJD1C AGCTAGTGGGAAAGCGGTTC AATTCCACGTAGACCGCCAG
ANP GAGGAGAAGATGCCGGTAG CAGAGAGGGAGCTAAGTG
BNP TTCCGGATCCAGGAGAGACTT CCTAAAACAACCTCAGCCCGT
a-MyHC CGAGTCCCAGGTCAACAAG AGGCTCTTTCTGCTGGACA
b-MyHC GAGGAGAGGGCGGACATT ACTCTTCATTCAGGCCCTTG
SKA AGAGCACGGCATTATCAC TCATCTTCTCACGGTTGG
CTGF AAGCCCAGGAGTGGGTGCCA GCTTCCTGTGAGTGCGCTGCT
TGF-b CACTCCCGTGGCTTCTAGTG CTTCGATGCGCTTCCGTTTC
Collagen I GACATCCCTGAAGTCAGCTGC TCCCTTGGGTCCCTCGAC
Collagen IV CGTAACTAACACACCCCGCT TGCACTGGATTGCAAAAGGC
b-Actin AAGTCCCTCACCCTCCCAAAAG AAGCAATGCTGTCACCTTCCC
2 S. ZHANG ET AL.
version 1.38e (Bethesda, MD) and normalized to their
respective control.
Luciferase assay
Control and JMJD1C knockdown H9c2 cells were transfected
with TIMP1 promoter reporter plasmid using Lipofectamine
2000. Renilla luciferase plasmid was used as a transfection
efficiency control [13]. After 24 h, cells were treated with Ang
II (1 lM) for 24 h and then harvested the cells and deter￾mined luciferase activity by using the Dual-Luciferase
Reporter Assay system (Promega, Cat#1910).
Chromatin immunoprecipitation (ChIP) assay
Control and JMJD1C knockdown H9c2 cells were treated with
Ang II (1 lM) for 24 h, and then the chromatin was immunopre￾cipitated by anti-H3K9me2 (Abcam, Cat#ab1220) antibodies, or
nonspecific IgG (Santa Cruz) (Dallas, TX). ChIP DNA were
purified by SimpleChIPVR
Enzymatic Chromatin IP Kit (CST,
Cat#9003) according the manufacturer’s instructions and ampli￾fied by real-time PCR for the TIMP1 promoter. Primers were as
follows, forward, 50
-AGGAAGGACTGTGCATGACG-30
, reverse, 50
-
GGCCCCAGGATAAACCCAAA-30
.
Statistical analysis
All data represent three independent experiments and are
expressed as mean ± SEM All statistical analyses were per￾formed with GraphPad Pro. Prism 8.0 (GraphPad, San Diego,
CA, USA). Student’s t test was employed to analyze the dif￾ferences. A p value <.05 was considered significant.
Results
Ang II induced JMJD1C expression in vitro and in vivo
It has been reported that the histone methylation regulators
promote transcriptional reprograming of fetal genes, a
Figure 1. Ang II-induced JMJD1C expression in vitro and in vivo. (A–B) The protein (A) and mRNA (B) levels in H9c2 cells. Cells were treated with Ang II (1 lM) for
24 h. The cells were homogenized in RIPA buffer and Trizol. The protein and mRNA levels were measured by western blot and RT-qPCR analysis. GAPDH and
b-actin acted as loading control. The experiments were repeated three times independently. p < .01, p < .001, p < .0001. (C–D) The protein (C) and
mRNA (D) levels in vehicle (n ¼ 6) and Ang II (n ¼ 6) group. The heart tissues were homogenized in RIPA buffer and Trizol. The protein and mRNA levels were
measured by western blot and RT-qPCR analysis. GAPDH and b-actin acted as loading control. p < .0001.
JOURNAL OF RECEPTORS AND SIGNAL TRANSDUCTION 3
hallmark of pathological cardiac hypertrophy [7–9]. The
expression of JMJD1C was upregulated and positively associ￾ated with heart diseases [7,10,11]. Ang II, the primary effector
hormone of the renin–angiotensin system, induced cardiac
hypertrophy [1]. So, we hypothesized that JMJD1C implicated
in Ang II-induced cardiac hypertrophy. Firstly, we measured
the protein and mRNA levels of JMJD1C in Ang II treated
H9c2 cells. H9c2 cells were treated with Ang II (1 lM) for
Figure 2. Knockdown of JMJD1C inhibited Ang II-induced cardiomyocyte hypertrophy. Control and JMJD1C knockdown H9c2 cells were treated with Ang II (1 lM)
for 24 h. The cells sizes were detected by immunofluorescence assay. The columns show the normalized optical density for data from three independent experi￾ments. The experiments were repeated three times independently. p < .01.
Figure 3. Knockdown of JMJD1C decreased Ang II-induced cardiomyocyte hypertrophic markers expression. (A–D) Control and JMJD1C knockdown H9c2 cells were
treated with Ang II (1 lM) for 24 h. The hypertrophic markers ANP (A), ANP (B), a/b-MyHC (C), and SKA (D) were detected by RT-qPCR. b-Actin acted as loading
control. The experiments were repeated three times independently. p < .01, p < .001, p < .0001.
4 S. ZHANG ET AL.
24 h, and then the cell was harvested to isolate protein and
RNA. The results showed that Ang II upregulated JMJD1C
protein (Figure 1(A)) and mRNA (Figure 1(B)) expression in
H9c2 cells analyzed by western blot and RT-qPCR.
Furthermore, we also analyzed the expression of JMJD1C in
Ang II infused heart. The western blot (Figure 1(C)) and RT￾qPCR (Figure 1(D)) results showed that Ang II induced
JMJD1C upregulation. These results confirmed that Ang II
can induced JMJD1C expression in vitro and in vivo, implicat￾ing that JMJD1C may promote hypertrophic heart diseases.
Knockdown of JMJD1C inhibited Ang II-induced
cardiomyocyte hypertrophy in vitro
To test whether JMJD1C played a vital role in cardiomyocyte
hypertrophy in vitro, JMJD1C stable knockdown H9c2 cells
were established by transfecting with the JMJD1C silenced
lentivirus (Figure 1(A)). Control and JMJD1C knockdown cells
were treated with Ang II (1 lM) for 24 h to induce cardio￾myocyte hypertrophy. The cell hypertrophy was measured by
immunofluorescence staining, and hypertrophic markers
were detected by RT-qPCR. As shown in Figure 2, knockdown
of JMJD1C can attenuate Ang II-induced H9c2 cell area
increase. Furthermore, Ang II can induce hypertrophic
markers ANP (atrial natriuretic peptide) (Figure 3(A)), BNP (B￾type natriuretic peptide) (Figure 3(B)), a/b-MyHC (a/b-myosin
heavy chain) (Figure 3(C)), and SKA (skeletal actin) (Figure
3(D)) expression, knockdown of JMJD1C decreased the
hypertrophic marker expression induced by Ang II in H9c2
cells. These data indicated that inhibition of JMJD1C attenu￾ated Ang II-induced cardiomyocyte hypertrophy.
Knockdown of JMJD1C suppressed Ang II induced pro￾fibrotic gene expression in H9c2 cells
To further test whether JMJD1C promotes cardiomyocyte
fibrosis in vitro[14–16]. Control and JMJD1C knockdown cells
were treated with Ang II (1 lM) for 24 h to induce cardio￾myocyte fibrosis. The cardiomyocyte fibrotic markers were
detected by RT-qPCR. As shown in Figure 4, Ang II can
increase the expression of fibrotic markers CTGF (connective
tissue growth factor) (Figure 4(A)), TGF-b (transforming
growth factor beta) (Figure 4(B)), Collagen I (type I collagen)
(Figure 4(C)), and Collagen IV (type IV collagen) (Figure 4(D)),
Figure 4. Knockdown of JMJD1C decreased Ang II-induced cardiomyocyte fibrotic markers expression. (A–D) Control and JMJD1C knockdown H9c2 cells were
treated with Ang II (1 lM) for 24 h. The fibrotic markers CTGF (A), TGF-b (B), Collagen I (C), and Collagen IV (D) were detected by RT-qPCR. b-Actin acted as loading
control. The experiments were repeated three times independently. p < .01, p < .001, p < .0001.
JOURNAL OF RECEPTORS AND SIGNAL TRANSDUCTION 5
knockdown of JMJD1C decreased the hypertrophic marker
expression induced by Ang II in H9c2 cells. These data indi￾cated that inhibition of JMJD1C attenuated Ang II-induced
cardiomyocyte fibrosis.
JIB-04 blocked Ang II induced cardiomyocyte
hypertrophy and fibrosis in vitro
JIB-04 was identified as a small molecule inhibitor of KDMs
and showed oral activity in tumor suppression and blocked
JMJD1A in vitro [7,17,18]. We also tested whether JIB-04
inhibited Ang II-induced cardiomyocyte hypertrophy and
fibrosis. H9c2 cells were pretreated with JIB-04 (0, 2.5, 5, and
10 lM) and then incubated with Ang II (1 lM) for 24 h to
induce cardiomyocyte hypertrophy and fibrosis. The results
showed that JIB-04 can significantly reduce Ang II-induced
hypertrophic markers ANP (Figure 5(A)), BNP (Figure 5(B)),
a/b-MyHC (a/b-myosin heavy chain) (Figure 5(C)), and SKA
(skeletal actin) (Figure 5(D)) expression in a dose-dependent
manner in H9c2 cells. Furthermore, JIB-04 can significantly
reduce Ang II-induced fibrotic markers CTGF (Figure 6(A)),
TGF-b (Figure 6(B)), Collagen I (Figure 6(C)), and Collagen IV
(Figure 6(D)) expression in a dose-dependent manner in
H9c2 cells. These data indicated that JIB-04 blocked Ang II￾induced cardiomyocyte hypertrophy and fibrosis.
Knockdown of JMJD1C suppressed TIMP1 transcription
by decreasing the H3K9me2 levels on TIMP1 promoter
The above results had demonstrated that inhibition of
JMJD1C suppressed Ang II-induced cardiomyocyte hyper￾trophy and fibrosis, so we further determined the mechan￾ism of JMJD1C inhibition regulating hypertrophy and
fibrosis. Tissue Inhibitor of Metalloproteinases 1 (TIMP1) has
been shown to promote fibrotic gene expression [19] and
elevated plasma TIMP1 levels have been conducted a fibro￾sis biomarker in patients who suffered from CVDs [20–23].
We hypothesized that knockdown of JMJD1C attenuated
cardiomyocyte hypertrophy and fibrosis by reducing TIMP1
expression. Control and JMJD1C knockdown cells were
treated with Ang II (1 lM) for 24 h, and then detected the
expression of TIMP1. As shown in Figure 7(A,B), Ang II
could induce TIMP1 expression and knockdown of JMJD1C
significantly reduced TIMP1 protein (Figure 7(A)) and mRNA
(Figure 7(B)) levels. It meant that knockdown of JMJD1C
reduced TIMP1 transcription. Then, we detected whether
knockdown of JMJD1C affected TIMP1 promoter reporter
activity. Control and JMJD1C knockdown H9c2 cells were
transfected with TIMP1 promoter reporter for 24 h, then
treated with Ang II (1 lM) for 24 h, luciferase activity assay
was performed. Knockdown of JMJD1C reduced TIMP1
reporter activity. H3K9me2-ChIP RT-qPCR results indicated
that Ang II decreased the H3K9me2 levels on TIMP1
Figure 5. JIB-04 blocked Ang II-induced cardiomyocyte hypertrophic markers expression. (A–D) H9c2 cells were pretreated with JIB-04 (0, 2.5, 5, and 10 lM) and
then incubated with Ang II (1 lM) for 24 h. The hypertrophic markers ANP (A), ANP (B), a/b-MyHC (C), and SKA (D) were detected by RT-qPCR. b-Actin acted as
loading control. The experiments were repeated three times independently. p < .05, p < .01, p < .001, p < .0001.
6 S. ZHANG ET AL.
promoter, however, knockdown of JMJD1C increased the
H3K9me2 levels. In all, the results indicated that knockdown
of JMJD1C reducing TIMP1 transcription by increasing
H3K9me2 levels on TIMP1 promoter.
Discussion
Cardiac hypertrophy induced by hypertension or aortic sten￾osis is regards as a major heart disease risk factor [24,25].
Physiological stress can also induce cardiomyocyte hyper￾trophy, however, the phenotype of the pathological stimuli
is significantly different, as it involves activation of the fetal
gene re-expression [9]. What causes this difference and
how the cardiomyocyte responses to stimuli are largely
unknown. Here, we identify that an epigenetic-based regu￾lator that determines the different transcriptional responses
of cardiomyocytes during the pathological hypertrophy
and fibrosis.
Since JMJDIC is upregulated in the heart tissue of patients
with heart diseases [7,10,11], we hypothesized that this upre￾gulation of JMJD1C may play an active role in promoting car￾diac hypertrophy. The key finding in the present study is
that the histone demethylase JMJD1C promotes cardiomyo￾cyte hypertrophy and fibrosis induced by Ang II. These are
supported by loss-of-function and a small molecular inhibitor
studies presented here. While inhibition of JMJD1C by
genetic and small molecular inhibitor in H9c2 weakens the
hypertrophic response (Figures 2, 3, and 5), and fibrosis
(Figures 4 and 6) to Ang II infusion in vitro. However, the
limitation of the current study was no in vivo data to support
our finding. TIMP1 has been reported in maintaining the
homeostasis of myocardial extracellular matrix (ECM) via
MMPs inhibition dependent and independent mechanisms
[19,26,27]. Elevated plasma TIMP1 levels have been con￾ducted as a fibrosis biomarker in patients who suffered from
CVDs [20–23]. We identified TIMP1 as a potential target of
JMJD1C that mediates its pro-fibrotic function since: (1)
TIMP1 was upregulated in cardiomyocytes in Ang II infusion,
(2) Ang II promoted Timp1 promoter reporter assay and
removed the methyl from H3K9me2 on the TIMP1 promoter,
(3) JMJD1C knockdown suppressed TIMP1 transcription by
increasing the H3K9me2 levels on the TIMP1 promoter.
Based on previous reports and our current study, it is
thus reasonable to speculate that TIMP1 may mediate the
pro-fibrotic function of JMJD1C. JMJD1C-activated TIMP1 in
cardiomyocytes may be secreted into the ECM, subsequently
activating resident cardiac fibroblasts and leading to myocar￾dial fibrosis.
It is well known that histone modifications play key roles
in gene transcription. Over the past decades, a great deal
has demonstrated that histone methylation plays a key role
in cardiac remodeling [7–9]. In our study, we identified a
Figure 6. JIB-04 blocked Ang II-induced cardiomyocyte fibrotic markers expression. (A–D) H9c2 cells were pretreated with JIB-04 (0, 2.5, 5, and 10 lM) and then
incubated with Ang II (1 lM) for 24 h. The fibrotic markers CTGF (A), TGF-b (B), Collagen I (C), and Collagen IV (D) were detected by RT-qPCR. b-Actin acted as
loading control. The experiments were repeated three times independently. p < .05, p < .01, p < .001, p < .0001.
JOURNAL OF RECEPTORS AND SIGNAL TRANSDUCTION 7
H3K9me2 and H3K9me1 demethylase JMJD1C involved in
cardiac hypertrophy and fibrosis induced by pathological
stress. JMJD1C is a global regulator of chromatin remodeling
and gene expression. Gene expression is mediated by tran￾scription factors and histone-modifying enzymes. Many dif￾ferent histone-modifying enzymes, including HDACs, HATs,
HMTs, and HDMs, contribute to the dynamic regulation of
chromatin structure and function, with concomitant impacts
on gene transcription [28–30]. Unlike transcription factors
that often have on-off effects on gene transcription, the
effects of histone-modifying enzymes on gene transcription
are often modulatory. This modulatory effect can be context￾and gene-dependent such that only those genes exceeded
the threshold will yield a phenotype and be identified. In our
study, we did not identify what genes were different in
JMJD1C knockdown and control cells, and which was regu￾lated by histone methylation change. It will be interesting to
identify these genes using RNA-seq and ChIP-seq combined
analysis to further investigate the relationship between
JMJD1C-regulated H3K9me2 marks which ultimately deter￾mines the transcriptional state of the gene as either active,
repressed, or poised for activation.
Conclusion
Our studies indicate that JMJD1C promotes cardiac hyper￾trophy and fibrosis in response to pathological stimuli.
Inhibition of JMJD1C attenuated cardiac hypertrophy and
fibrosis, targeting JMJD1C could be a potential drug target
for transcriptional therapy against cardiac hypertrophy
and HF.
Author contributions
SZ and CJ conceived and coordinated the study. SZ and CJ wrote the
paper. SZ, YL and CJ designed, performed, and analyzed the experi￾ments. All authors reviewed the results and approved the final version
of the manuscript.
Disclosure statement
No potential conflict of interest was reported by the author(s).
Funding
This work was supported by Zhejiang Medical Association Scientific
Research Fund Project [2B01603].
Figure 7. Knockdown of JMJD1C decreased TIMP1 transcription induced by Ang II. (A–B) The protein (A) and mRNA (B) levels of TIMP1 in H9c2 cells. Control and
JMJD1C knockdown H9c2 cells were treated with Ang II (1 lM) for 24 h. The cells were homogenized in RIPA buffer and Trizol. The protein and mRNA levels were
measured by western blot and RT-qPCR analysis. GAPDH and b-actin acted as loading control. (C) Knockdown of JMJD1C reduced the TIMP1 promoter reporter
activity. Control and JMJD1C knockdown H9c2 cells were transfected with TIMP1 promoter reporter for 24 h and then treated with Ang II (1 lM) for 24 h.
Luciferase activity assay was performed. (D) Knockdown of JMJD1C increased the H3K9me2 levels on the TIMP1 promoter. Control and JMJD1C knockdown H9c2
cells were treated with Ang II (1 lM) for 24 h. ChIP assay was performed. All the experiments were repeated three times independently. p < .01, p < .001, p < .0001.
8 S. ZHANG ET AL.
References
[1] Peng K, Tian X, Qian Y, et al. Novel EGFR inhibitors attenuate car￾diac hypertrophy induced by angiotensin II. J Cell Mol Med. 2016;
20(3):482–494.
[2] Frey N, Olson EN. Cardiac hypertrophy: the good, the bad, and
the ugly. Annu Rev Physiol. 2003;65(1):45–79.
[3] Binder H, Steiner L, Przybilla J, et al. Transcriptional regulation by
histone modifications: towards a theory of chromatin re-organiza￾tion during stem cell differentiation. Phys Biol. 2013;10(2):026006.
[4] Kang Z, Janne OA, Palvimo JJ. Coregulator recruitment and his￾tone modifications in transcriptional regulation by the androgen
receptor. Mol Endocrinol. 2004;18(11):2633–2648.
[5] Berger SL. Histone modifications in transcriptional regulation.
Curr Opin Genet Dev. 2002;12(2):142–148.
[6] Kouzarides T. Histone methylation in transcriptional control. Curr
Opin Genet Dev. 2002;12(2):198–209.
[7] Zhang QJ, Tran TAT, Wang M, et al. Histone lysine dimethyl￾demethylase KDM3A controls pathological cardiac hypertrophy
and fibrosis. Nat Commun. 2018;9(1):5230.
[8] Zhang QJ, Chen HZ, Wang L, et al. The histone trimethyllysine
demethylase JMJD2A promotes cardiac hypertrophy in response
to hypertrophic stimuli in mice. J Clin Invest. 2011;121(6):
2447–2456.
[9] Thienpont B, Aronsen JM, Robinson EL, et al. The H3K9 dimethyl￾transferases EHMT1/2 protect against pathological cardiac hyper￾trophy. J Clin Invest. 2016;127(1):335–348.
[10] Yousefi K, Irion CI, Takeuchi LM, et al. Osteopontin promotes left
ventricular diastolic dysfunction through a mitochondrial path￾way. J Am Coll Cardiol. 2019;73(21):2705–2718.
[11] Luo S, Au Yeung SL, Zhao JV, et al. Association of genetically pre￾dicted testosterone with thromboembolism, heart failure, and
myocardial infarction: mendelian randomisation study in UK
Biobank. BMJ. 2019; 364:l476.
[12] Zhou G, Li X, Hein DW, et al. Metallothionein suppresses angio￾tensin II-induced nicotinamide adenine dinucleotide phosphate
oxidase activation, nitrosative stress, apoptosis, and pathological
remodeling in the diabetic heart. J Am Coll Cardiol. 2008;52(8):
655–666.
[13] Zhao W, Chang C, Cui Y, et al. Steroid receptor coactivator-3 reg￾ulates glucose metabolism in bladder cancer cells through coacti￾vation of hypoxia inducible factor 1alpha. J Biol Chem. 2014;
289(16):11219–11229.
[14] Teekakirikul P, Eminaga S, Toka O, et al. Cardiac fibrosis in mice
with hypertrophic cardiomyopathy is mediated by non-myocyte
proliferation and requires Tgf-beta. J Clin Invest. 2010;120(10):
3520–3529.
[15] Tzanidis A, Hannan RD, Thomas WG, et al. Direct actions of uro￾tensin II on the heart: implications for cardiac fibrosis and hyper￾trophy. Circ Res. 2003;93(3):246–253.
[16] Weber KT, Brilla CG. Pathological hypertrophy and cardiac inter￾stitium. Fibrosis and renin–angiotensin–aldosterone system.
Circulation. 1991;83(6):1849–1865.
[17] Wang L, Chang J, Varghese D, et al. A small molecule modulates
Jumonji histone demethylase activity and selectively inhibits can￾cer growth. Nat Commun. 2013;4(1):2035.
[18] Duan L, Rai G, Roggero C, et al. KDM4/JMJD2 histone demethy￾lase inhibitors block prostate tumor growth by suppressing the
expression of AR and BMYB-regulated genes. Chem Biol. 2015;
22(9):1185–1196.
[19] Takawale A, Zhang P, Patel VB, et al. Tissue inhibitor of matrix
metalloproteinase-1 promotes myocardial fibrosis by mediating
CD63-integrin beta1 interaction. Hypertension. 2017;69(6):
1092–1103.
[20] Essa EM, Zile MR, Stroud RE, et al. Changes in plasma profiles of
matrix metalloproteinases (MMPs) and tissue inhibitors of MMPs
in stress-induced cardiomyopathy. J Card Fail. 2012;18(6):
487–492.
[21] Lopez B, Gonzalez A, Diez J. Circulating biomarkers of collagen
metabolism in cardiac diseases. Circulation. 2010;121:1645–1654.
[22] Szmigielski C, Raczkowska M, Styczynski G, et al. Relations of
plasma total TIMP-1 levels to cardiovascular risk factors and echo￾cardiographic measures: the Framingham Heart Study. Eur Heart
J. 2005;26:418. author reply 418-9.
[23] Sundstrom J, Evans JC, Benjamin EJ, et al. Relations of plasma
total TIMP-1 levels to cardiovascular risk factors and echocardio￾graphic measures: the Framingham heart study. Eur Heart J.
2004;25(17):1509–1516.
[24] Shiojima I, Sato K, Izumiya Y, et al. Disruption of coordinated car￾diac hypertrophy and angiogenesis contributes to the transition
to heart failure. J Clin Invest. 2005;115(8):2108–2118.
[25] Grossman W. Cardiac hypertrophy: useful adaptation or patho￾logic process? Am J Med. 1980;69(4):576–584.
[26] Ikonomidis JS, Hendrick JW, Parkhurst AM, et al. Accelerated LV
remodeling after myocardial infarction in TIMP-1-deficient mice:
effects of exogenous MMP inhibition. Am J Physiol Heart Circ
Physiol. 2005;288(1):H149–H158.
[27] Creemers EE, Davis JN, Parkhurst AM, et al. Deficiency of TIMP-1
exacerbates LV remodeling after myocardial infarction in mice.
Am J Physiol Heart Circ Physiol. 2003;284(1):H364–H371.
[28] Butler JS, Koutelou E, Schibler AC, et al. Histone-modifying
enzymes: regulators of developmental decisions and drivers of
human disease. Epigenomics. 2012;4(2):163–177.
[29] Lin W, Dent SY. Functions of histone-modifying enzymes in
development. Curr Opin Genet Dev. 2006;16(2):137–142.
[30] Marmorstein R, Trievel RC. Histone modifying enzymes: structures,
mechanisms, and specificities. Biochim Biophys Acta. 2009;
1789(1):58–68.
JOURNAL OF RECEPTORS AND SIGNAL TRANSDUCTION 9