“
“Malaghan Institute of Medical Research, Wellington, New Zealand Antiretroviral therapy (ART) suppresses HIV viraemia, thereby reducing

the antigenic drive for T cells to proliferate. Accordingly, selected HIV-specific T-cell responses have been described to contract within weeks of ART initiation. Here, we sought to investigate whether these findings apply to the entire repertoire of HIV-specific T cells. Using interferon (IFN)-γ enzyme linked immuno spot (ELISpot), we performed retrospective 2-year proteome-wide monitoring of HIV-specific T cells in 17 individuals with undetectable viral loads during ART. The sample pool for each study subject consisted of one pre-ART time-point and at

least two time-points after initiation of therapy. Peripheral pools of HIV-specific T cells decreased nonsignificantly within the first 2 years under ART in our cohort selleck products of patients, in terms of both breadth and magnitude. However, in most cases, the seeming decrease masked ongoing expansion of individual PARP activity HIV-specific T-cell responses. We detected synchronous contraction and expansion of T-cell responses – with different peptide specificities – in 12 out of 17 study participants during follow-up. Importantly, the observed expansions and contractions of individual HIV-specific T-cell responses reached similar ranges, supporting the biological relevance of our findings. We conclude that successful ART enables both contraction and expansion of HIV-specific T-cell responses. this website Our results should prompt a renewed interest in HIV-specific T-cell dynamics under ART, in particular to elucidate the mechanisms that uncouple, to some extent, particular HIV-specific

T-cell responses from variations in circulating antigen load and functionally characterize expanding/contracting T-cell populations beyond IFN-γ secretion. Assuming that expanding HIV-specific T-cell responses under ART are protective and functional, harnessing those mechanisms may provide novel opportunities for assisting viral control in chronically infected individuals. “
“Amino acid insertions in the protease gene have been reported rarely, and mainly in patients receiving protease inhibitors (PIs). The aim of the study was to assess the long-term viro-immunological follow-up of HIV-infected patients harbouring virus with protease insertions. Cases of virus exhibiting protease insertions were identified in routine resistance genotyping tests. Therapeutic, immunological and virological data were retrospectively collected. Eleven patients harbouring virus with a protease gene insertion were detected (prevalence 0.24%), including three PI-naïve patients. The insertions were mainly located between codons 33 and 39 and associated with surrounding mutations (M36I/L and R41K). The three PI-naïve patients were infected with an HIV-1 non-B subtype.

“
“Malaghan Institute of Medical Research, Wellington, New Zealand Antiretroviral therapy (ART) suppresses HIV viraemia, thereby reducing

the antigenic drive for T cells to proliferate. Accordingly, selected HIV-specific T-cell responses have been described to contract within weeks of ART initiation. Here, we sought to investigate whether these findings apply to the entire repertoire of HIV-specific T cells. Using interferon (IFN)-γ enzyme linked immuno spot (ELISpot), we performed retrospective 2-year proteome-wide monitoring of HIV-specific T cells in 17 individuals with undetectable viral loads during ART. The sample pool for each study subject consisted of one pre-ART time-point and at

least two time-points after initiation of therapy. Peripheral pools of HIV-specific T cells decreased nonsignificantly within the first 2 years under ART in our cohort this website of patients, in terms of both breadth and magnitude. However, in most cases, the seeming decrease masked ongoing expansion of individual selleck chemicals llc HIV-specific T-cell responses. We detected synchronous contraction and expansion of T-cell responses – with different peptide specificities – in 12 out of 17 study participants during follow-up. Importantly, the observed expansions and contractions of individual HIV-specific T-cell responses reached similar ranges, supporting the biological relevance of our findings. We conclude that successful ART enables both contraction and expansion of HIV-specific T-cell responses. STK38 Our results should prompt a renewed interest in HIV-specific T-cell dynamics under ART, in particular to elucidate the mechanisms that uncouple, to some extent, particular HIV-specific

T-cell responses from variations in circulating antigen load and functionally characterize expanding/contracting T-cell populations beyond IFN-γ secretion. Assuming that expanding HIV-specific T-cell responses under ART are protective and functional, harnessing those mechanisms may provide novel opportunities for assisting viral control in chronically infected individuals. “
“Amino acid insertions in the protease gene have been reported rarely, and mainly in patients receiving protease inhibitors (PIs). The aim of the study was to assess the long-term viro-immunological follow-up of HIV-infected patients harbouring virus with protease insertions. Cases of virus exhibiting protease insertions were identified in routine resistance genotyping tests. Therapeutic, immunological and virological data were retrospectively collected. Eleven patients harbouring virus with a protease gene insertion were detected (prevalence 0.24%), including three PI-naïve patients. The insertions were mainly located between codons 33 and 39 and associated with surrounding mutations (M36I/L and R41K). The three PI-naïve patients were infected with an HIV-1 non-B subtype.

“
“The ventral striatum seems to play an important role during working memory (WM) tasks when irrelevant information needs to be filtered out. However, the concrete neural mechanisms underlying this process are still unknown. In this study, we investigated these mechanisms Obeticholic Acid chemical structure in detail. Eighteen healthy human participants were presented with multiple items consisting of faces or buildings. They either had to maintain two or four

items from one category (low- and high-memory-load condition), or two from one category and suppress (filter out) two items from the other category (distraction condition). Striatal activity was increased in the distraction as compared with the high-load condition. Activity in category-specific regions in the inferior temporal cortex [fusiform face area (FFA) and parahippocampal place area (PPA)] was reduced when items from the other category INK 128 in vitro needed to be selectively maintained. Furthermore, functional connectivity analysis showed significant reduction of striatal–PPA correlations during selective maintenance of faces. However, striatal–FFA connectivity was not reduced during maintenance of buildings vs. faces, possibly because face stimuli are more salient. Taken together, our results suggest that the ventral striatum supports selective WM maintenance by reduced gating of task-irrelevant activity via attenuating functional connectivity without increasing task-relevant activity correspondingly.

“
“Transcranial magnetic stimulation (TMS) over the occipital pole can produce an illusory percept of a light flash (or ‘phosphene’), suggesting an excitatory effect. Whereas previous reported effects produced by single-pulse occipital pole TMS are typically disruptive, here we report the first demonstration of a location-specific facilitatory effect on visual perception in humans. Observers performed a spatial cueing orientation discrimination task. An

orientation target was presented in one of two peripheral placeholders. A single pulse below the phosphene threshold applied to the occipital pole 150 or 200 ms before stimulus onset was found to facilitate target Oxalosuccinic acid discrimination in the contralateral compared with the ipsilateral visual field. At the 150-ms time window contralateral TMS also amplified cueing effects, increasing both facilitation effects for valid cues and interference effects for invalid cues. These results are the first to show location-specific enhanced visual perception with single-pulse occipital pole stimulation prior to stimulus presentation, suggesting that occipital stimulation can enhance the excitability of visual cortex to subsequent perception. “
“Corticosterone (CORT) is a glucocorticoid produced by adrenal glands under the control of the hypothalamic–pituitary–adrenal axis. Circulating CORT can enter the central nervous system and be reduced to neuroactive 3α5α-reduced steroids, which modulate GABAA receptors.

Fig. S1. Contribution of Na+ cannels to the light dependentspiking activity. (A) Schematic diagram of the experiment. TTX(100 μm, 0.2 μL) was applied to near the

probe tipvia a glass pipette. (B) Typical effect of TTX on light elicitedactivity. Light dependent activities were recorded before (Control)and 5 min buy LGK-974 after drug applications (Saline, TTX). In manycases, light dependent activity was not detected after TTXtreatment (Left). Sometimes transient activity at lightonset was remained after TTX treatment (Right). Laser powerfor stimulation was 0.6 mW. Fig. S2. Measurement of spatial specificity. (A) Light irradiation at the tip of the optical fiber bundle. Stimulating light was emitted from one core at the tip of the bundle. (B) Upper, Photostimulation of recorded cell with optical fiberbundle. a: Recording pipette, b: Optical fiber bundle.Lower, Stimulating light was emitted at the bundle’stip. (C) Whole-cell current clamp recordings (Upper) orcell-attach recordings (Lower) in response to 0.5 slight pulses

of various light intensities. Laser power forphotostimulation was 1.2 mW at maximum light intensity(denoted as 512). Voltage traces during five repetition ofphotostimulation series were displayed. For whole-cell recording,membrane potential at rest was held around −70 mV byinjecting bias current. Fig. S3. Spatial resolution ERK inhibitor of action potential generation.Relationships between light intensity and spike probability weremeasured at various photostimulation points. (A) Stimulation pointwas moved along the axial axis of the bundle. Values selleck chemicals llc on the leftside of the graph indicate distance between recorded cell and thetip of the bundle. (B) Stimulation point was moved along a lineperpendicular to the bundle’s axial axis. Values on the leftside of the graph indicate distance between recorded cell and thetip of the bundle. Laser power for photostimulation was 1.2 mWat maximum light intensity (denoted as 512). As a service to our authors and readers, this journal provides supporting information

supplied by the authors. Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset by Wiley-Blackwell. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors. “
“Locomotor activity like walking or flying has recently been shown to alter visual processing in several species. In insects, the neuromodulator octopamine is thought to play an important role in mediating state changes during locomotion of the animal [K.D. Longden & H.G. Krapp (2009) J. Neurophysiol., 102, 3606–3618; (2010) Front. Syst. Neurosci., 4, 153; S.N. Jung et al. (2011)J. Neurosci., 31, 9231–9237]. Here, we used the octopamine agonist chlordimeform (CDM) to mimic effects of behavioural state changes on visual motion processing. We recorded from identified motion-sensitive visual interneurons in the lobula plate of the blowfly Calliphora vicina.

Of these patients, 479 (34%) had GDC-0199 mouse a strictly undetectable VL (group 1), 617 (44%) a detectable VL below the threshold of 20 copies/mL (group 2), and 296 (21%) a VL of 20–50 copies/mL (group 3). The mean VL in group 3 was 37 copies/mL. Characteristics of the patients are shown in Table 1. As compared with groups 2 and 3, patients in group 1 had, in the univariate analysis, a significantly longer history of HIV infection (P = 0.02), a longer total duration of cART (P = 0.02) and a longer

duration of viral suppression (P = 0.0001). They had also a lower VL zenith (P = 0.0001) and less frequently a VL zenith > 5 log10 copies/mL (P < 0.0001). The current mean CD4 T-cell count was lower in patients in group 1 (P = 0.04). Patients in group 1 were more likely to receive a regimen based on NNRTI (51%) than on bPI (39%), and the opposite was the case for patients in group 3 (39 and 50%, respectively) (P = 0.0008). Age, gender, hepatitis coinfection, route of HIV infection, AIDS-defining events (stage C), total duration of current cART regimen, type of first antiretroviral regimen, number of previous antiretroviral regimens, CD4 count nadir, current CD8 count and CD4:CD8 ratio

did not differ significantly between groups. We could find no separate drug effect within the different classes. In the multivariate analysis, independent factors related to being in group 1 vs. group 2 were a VL zenith < 5 log10 copies/mL [odds ratio (OR) 1.51; 95% confidence interval (CI) 1.15–1.99; P = 0.003], a current CD4 count < 500 cells/μL (OR 1.44; 95% CI 1.08–1.92; P = 0.01), and a duration of viral suppression < 50 copies/mL this website longer than 2 years (OR 2.32; 95% CI 1.20–4.54; P = 0.01) (Fig. 1a). Factors related to being in group 1 vs. group 3 were a VL zenith < 5 log10 copies/mL (OR 2.48; 95% CI 1.75–3.50; P < 0.001), an NNRTI-based regimen either (OR 1.45; 95% CI 1.03–2.04; P = 0.03), and a duration of viral suppression < 50 copies/mL longer than 1 year (OR 3.33; 95% CI 1.66–6.66; P = 0.0006) (Fig. 1b). There was no significant interaction between the duration of viral suppression and the cART regimen. Using a routine RT-PCR assay,

we compared cART-treated patients experiencing low-level viraemia below 50 copies/mL with those with a strictly undetectable VL. Thirty-four per cent of the studied patients had a strictly undetectable VL. We showed that a duration of viral suppression < 50 copies/mL longer than 1 or 2 years, VL zenith < 5 log10 copies/mL, and NNRTI-based cART were, in this cross-sectional study, independently associated with a strictly undetectable VL. Several recent studies have tried to characterize patients presenting strictly undetectable VL under suppressive cART. However, while they used mainly complex ultrasensitive assays limited to research settings, we used in our study a routine RT-PCR assay for quantifying low levels of HIV-1 RNA.

flexneri) to localize at the cell pole(s) (Jain et al., 2006). The NalP autotransporter from Neisseria meningitidis localizes to the poles of E. coli during heterologous expression of the protein (Jain et al., 2006). In addition, the Listeria monocytogenes surface protein ActA localizes to the bacterial pole, where it is involved in actin-based motility (Rafelski & Theriot, 2006). These examples indicate that an array of bacterial virulence stratagems use polar localization as a means to secrete effector proteins into host cells. Coxiella burnetii’s ability to affect host cell function while sequestered in the PV, and the lack of understanding of its T4BSS structure,

led us to investigate the subcellular localization of the C. burnetii T4BSS. Using antibodies specific to the C. burnetii IcmT, IcmV, and DotH homologs, Palbociclib indirect immunofluorescent antibody (IFA) assays demonstrated that IcmT, IcmV, and DotH localized to one or both poles of the bacterium. We confirmed these findings with immunoelectron microscopy (IEM). To our knowledge, this is the first demonstration of the specific subcellular

localization of this virulence machinery during C. burnetii infection. Coxiella burnetii Nine Mile Phase II Clone 4 (NMII) was propagated in African green monkey kidney (Vero) cells in Roswell Park Memorial Institute (RPMI) 1640 medium, 5% fetal bovine serum (FBS) at 37 °C in an atmosphere of 5% CO2, and the SCV form of the organism was isolated as described previously (Coleman et al., 2004). The SCVs were resuspended in SPG buffer (0.7 M sucrose, 3.7 mM KH2PO4, 6.0 mM K2HPO4, 0.15 M KCl, MDV3100 and 5.0 mM glutamic acid, pH 7.4) and stored at −80 °C. Coxiella burnetii genome equivalents were calculated using qPCR (Brennan & Samuel, 2003). Uninfected Vero cells were propagated as described in a medium containing 20 μg mL−1 gentamicin. The medium was exchanged with fresh RPMI 1640, 5% FBS without antibiotics 2 h before bacterial infection. Vero cells were infected with C. burnetii NMII using a genome-equivalent C-X-C chemokine receptor type 7 (CXCR-7) MOI of

100. Infections were propagated as described for 3 weeks with periodic medium changes and maintenance of cell confluency as needed. The oligonucleotide primers used for the PCR amplification of icmT, icmV, and dotH from C. burnetii NMII genomic DNA were icmT: 5′CACCATGAAATCTCTCGATGAGG (forward) and 5′TTAGTTATCCCACCATGCTATGG (reverse), icmV: 5′CACCATGATTCTTTTGGAGTCTTCC (forward) and 5′TTATTGTTTGGACCCCTTAAAGGTG (reverse), dotH: 5′CACCATGGTGATTCGAAAAATTTTCC (forward) and 5′TTACAACCCTTCAATCATCAAC (reverse). Underlined and italicized bases, CACC and TTA, are non-C. burnetii sequences used for directional cloning and stop codon insertion, respectively. PCR products from each gene were ligated into the pET200/D-TOPO vector and transformed into E. coli TOP10 cells according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Selected clones were cultivated at 37 °C in Luria–Bertani broth containing 50 μg mL−1 kanamycin and sequence verified.

These are single-strand (DNA) annealing proteins (SSAPs) that are related to the ERF protein of phage P22 that mediates circularization of linear double-stranded DNA following infection of the host cell (Poteete, 1982). The gene product

of PHIEF11_0044 also shows similarity to a single-stranded DNA-binding protein of a prophage of S. pyogenes MGA55005, and an SSAP of Lactococcus phage ul36.13. PHIEF11_0045 shows similarity to a replication protein of L. johnsonii prophage Lj928 (Table 1) and is presumably involved Sunitinib in the replication of the φEf11 DNA. Replisome organizers, such as the DnaA protein of E. coli, function as initiators of DNA replication. They act by binding to the origin of replication (ori) and promote unwinding of the DNA. The unwound region of the DNA allows access of helicases such as DnaB/DnaC, and other proteins required for DNA polymerization, to replicate the DNA (Missich et al., 1997; Majka et al., 2001). PHIEF11_0047 contains a conserved domain of phage replisome organizer proteins from several different phages (Table 1). These include similarities in sequence to the replisome organizer domains of proteins from Listeria monocytogenes phage A118, S. aureus phage 52A, a Clostridium botulinum phage, and Streptococcus mitis phage SM10. Therefore,

PHIEF11_0047 appears to be a replisome organizer protein. Additional genes in the DNA replication/modification module include a putative methyltransferase (PHIEF11_0050), an learn more ASCH domain protein (PHIEF11_0054), and a SbcC domain protein (PHIEF11_0061). The domains found in these gene products are all associated with DNA replication functions. In addition, the final gene of this module (PHIEF11_0065) is similar to a gene of S. pyogenes phage SM1 that is in turn similar in sequence to a gene of Streptococcus phage NZ131.3 that functions in DNA replication (e.g. DNA polymerase III β-subunit/dnaN). PHIEF11_0062 has a significant HMM match to PF02195: ParB-like nuclease domain, suggesting a possible role in DNA replication. The location of

the lysogenized φEf11 genome within the lysogenic host TUSoD11 was investigated computationally by mapping the complete genome of φEf11 to the unfinished (draft) genome of E. faecalis strain TUSoD11 filipin (GenBank accession ACOX00000000), using NUCMER (Delcher et al., 2002). Analysis of the SHOW-COORDS output of the NUCMER package indicated the integrated genome of φEf11 spread across three contigs (ACOX01000066, 44 534 bp; ACOX01000045, 647 bp; and ACOX01000055, 103 862 bp), ordered relative to the φEf11 genome beginning with the integrase gene. Examination of the ends of alignments with TUSoD11 as the reference revealed a putative 27 bp attachment site with the sequence (ACTAAGCAAGTGCCGCCATGTGTCTGA), manifested as a direct repeat.

Another study demonstrated that the risk of S.

aureus infection among colonized HIV-infected Alisertib solubility dmso patients with CD4 counts <100 cells/μL was as high as 10% for every 6-month interval over which they were colonized. Bloodstream infections and skin and soft issue infections (SSTIs) were the most common types of infection described in this study, and were largely community-acquired (CA). Furthermore, most infecting strains were identical to the colonizing S. aureus strain [2]. Historically, infections caused by methicillin-resistant Staphylococcus aureus (MRSA) impart a higher morbidity and mortality compared with infections caused by methicillin-susceptible S. aureus [5]. Among HIV-negative patients, established risk factors for MRSA colonization and infection include a history of hospitalization, a history of a surgical procedure, haemodialysis, the presence of an indwelling catheter, and residence in a long-term care facility [6]. Clinical AIDS has also been described as a risk for MRSA colonization, and this has been attributed to various behavioural factors and underlying medical conditions. Among HIV-infected patients, studies differ in their identification of risk factors for MRSA infection and have included a CD4 count <50 cells/μL, an HIV viral load

greater than 100 000 HIV-1 RNA copies/ml, HIV acquisition via men who have sex with men (MSM), use of beta-lactam antibiotics within 6 months, a history of syphilis, undergoing an invasive procedure within 12 months, prior incarceration, past or STA-9090 molecular weight current injecting drug use (IDU), and lack of trimethoprim-sulfamethoxazole prophylaxis for more than 4 months [7–10]. Additionally, the emerging epidemiology of USA-300 CA MRSA among HIV-infected patients has not been fully described with regard to the impact of the USA-300 CA-MRSA strain. The goal of our study was to describe the epidemiology of MRSA in our HIV-infected patient population, which predominantly consists of heterosexual

minorities, in order to identify risk factors for MRSA colonization or infection as well as those for USA-300 CA-MRSA colonization or infection. The Infectious Diseases (ID) out-patient clinic is affiliated with the Medical University of South Carolina (MUSC), a 650-bed academic medical centre located in Charleston, South Carolina, USA. We Tacrolimus (FK506) performed a retrospective chart review of 900 HIV-infected patients who received care at our ID clinic from January 2002 until December 2007 to identify those who were colonized or infected with MRSA. Our study was approved by the MUSC institutional review board. To determine risk factors associated with MRSA colonization or infection, we performed an unmatched case–control study in which cases were defined as HIV-infected patients seen at least once in the ID clinic during the study period, who were colonized or infected with MRSA at any time after their HIV diagnosis.

Another study demonstrated that the risk of S.

aureus infection among colonized HIV-infected Selleck Linsitinib patients with CD4 counts <100 cells/μL was as high as 10% for every 6-month interval over which they were colonized. Bloodstream infections and skin and soft issue infections (SSTIs) were the most common types of infection described in this study, and were largely community-acquired (CA). Furthermore, most infecting strains were identical to the colonizing S. aureus strain [2]. Historically, infections caused by methicillin-resistant Staphylococcus aureus (MRSA) impart a higher morbidity and mortality compared with infections caused by methicillin-susceptible S. aureus [5]. Among HIV-negative patients, established risk factors for MRSA colonization and infection include a history of hospitalization, a history of a surgical procedure, haemodialysis, the presence of an indwelling catheter, and residence in a long-term care facility [6]. Clinical AIDS has also been described as a risk for MRSA colonization, and this has been attributed to various behavioural factors and underlying medical conditions. Among HIV-infected patients, studies differ in their identification of risk factors for MRSA infection and have included a CD4 count <50 cells/μL, an HIV viral load

greater than 100 000 HIV-1 RNA copies/ml, HIV acquisition via men who have sex with men (MSM), use of beta-lactam antibiotics within 6 months, a history of syphilis, undergoing an invasive procedure within 12 months, prior incarceration, past or PD0332991 nmr current injecting drug use (IDU), and lack of trimethoprim-sulfamethoxazole prophylaxis for more than 4 months [7–10]. Additionally, the emerging epidemiology of USA-300 CA MRSA among HIV-infected patients has not been fully described with regard to the impact of the USA-300 CA-MRSA strain. The goal of our study was to describe the epidemiology of MRSA in our HIV-infected patient population, which predominantly consists of heterosexual

minorities, in order to identify risk factors for MRSA colonization or infection as well as those for USA-300 CA-MRSA colonization or infection. The Infectious Diseases (ID) out-patient clinic is affiliated with the Medical University of South Carolina (MUSC), a 650-bed academic medical centre located in Charleston, South Carolina, USA. We Carnitine palmitoyltransferase II performed a retrospective chart review of 900 HIV-infected patients who received care at our ID clinic from January 2002 until December 2007 to identify those who were colonized or infected with MRSA. Our study was approved by the MUSC institutional review board. To determine risk factors associated with MRSA colonization or infection, we performed an unmatched case–control study in which cases were defined as HIV-infected patients seen at least once in the ID clinic during the study period, who were colonized or infected with MRSA at any time after their HIV diagnosis.

For Asia, rates for typhoid fever and shigellosis declined, whereas rates for hepatitis A remained stable. This finding may reflect the disproportionate impact of the Indian subcontinent, with stable trends, on trends for Asia overall: 75% of all Asian hepatitis A cases were contracted in the Indian subcontinent, compared to <60% for shigellosis and typhoid fever (data not shown). The trends in attack rates we found

for hepatitis A and typhoid fever correlate with findings in other studies.5–7 One study on travel-related shigellosis discusses only absolute attack rates; these correlate with the median rates we calculated.17 The Dutch policy not to recommend typhoid fever vaccination for Epacadostat short-term travelers to Latin America, Eastern/Southern Sub-Saharan Africa, Turkey, and Thailand/Malaysia appears to be justified, because

median attack rates for these destinations were less than 0.2 per 100,000 travelers (Table 2), and vaccine-failure occurred in at least 21% of cases (Table 1). This study has some possible limitations. Although the three infections are comparable in their mode of transmission, they differ in ways that influence reporting. For example, the short incubation period for shigellosis (1–7 d) as opposed to hepatitis A (2–7 wk) increases its chance find more of occurring abroad, decreasing its chance of being reported in the Netherlands. Also, the three diseases differ in degree of asymptomatic infection, patients’ medical attention-seeking behavior, and doctors’ tendency to request laboratory confirmation. Hepatitis A virus infection in childhood is often asymptomatic, but occurs with varying severity of illness in adults. In typical shigellosis, stools contain blood and mucus, but may also present as watery diarrhea or asymptomatic infection. Typhoid fever symptoms can likewise range from asymptomatic to severe. Susceptibility for the latter two increases in a setting of gastric achlorhydria or immunosuppression. These variations in disease severity undoubtedly influence the chance of being diagnosed,

and thus the chance of being reported. However, there are no reasons to believe that the impact of these factors changed during the study period. Thus, they have led only to an underestimation of the annual MYO10 attack rates, without affecting trends in attack rates. Serology is not an accurate method for the diagnosis of typhoid fever, because of cross-reactivity. However, the proportion of serological confirmed cases was low (6.4%), and it did not change during the study period. Thus, trends in attack rates were not affected. In our study, the number of annually reported cases was put into perspective by using numbers of travelers as denominators. The latter are crude estimates. Country-specific data were used after classification into regions to render findings more robust.