The high levels of secretion and the degree of conservation within the genus are congruent Selleckchem 4EGI-1 with Pam modulating these important activities. Very little is known about Photorhabdus infections in humans, but a recent study has found that, unlike the extracellular growth of P. luminescens in insects [27], a clinical isolate of P. asymbiotica is a facultative intracellular pathogen when incubated with human

macrophage-like cells [28]. Future studies may investigate what role if any Pam has in the infection of mammalian cells. Conclusions In this study we show that the highly abundant Pam protein is able to bind to exopolysaccharides and change the attachment properties of Photorhabdus. Deletion of pam altered bacterial adhesion to surfaces but did not cause a decrease in virulence towards Galleria mellonella larvae. However, Pam is produced during insect infection

suggesting a role for this protein in the insect cadaver, possibly in the colonization of the insect body. Sequence analysis of pam in multiple isolates showed that it is ancestral and conserved in the genus Photorhabdus and thus deserves further investigations to clarify its role in the complex cycle of Photorhabdus biology. Methods Bacterial strains, plasmids and culture conditions. DNA amplification and cloning The strains used in this study are: P. asymbiotica strain ATCC43949 [29], P. luminescens subspecies laumondii strain TT01 [30] and a wild-type spontaneous rifampicin-resistant Glycogen branching enzyme Selleck Daporinad P. luminescens TT01rif (this study). A knock-out strain in the pam gene was constructed from TT01rif and named TT01pam. The pam gene was deleted from the chromosome by allelic exchange using the suicide vector pDS132 [31] and correct chromosomal

deletion was confirmed by PCR and DNA sequencing of the region near the deleted gene. The pam knock-out strain grew similarly to the wild-type strain in rich and minimal media and insect plasma (filtered hemolymph). Escherichia coli EC100 (Epicentre Biotechnology, USA) was used for heterologous production of Pam. The pam gene was PCR amplified from P. asymbiotica ATCC43949 genomic DNA using the primers PamF: 5′ TTAATCTTGGAATTCATTAAACACATT 3′ and PamR: 5′ TTAAAGCTTAGGTTACAATAGTATATTCT 3′. Using EcoRI and HinDIII restriction sites incorporated in the primers, the product was directionally cloned downstream of an arabinose-inducible promoter in the ALK inhibitor pBAD30 plasmid [32] to create the pBADpam expression construct. Pam expression in E. coli EC100 containing pBADpam was induced by addition of 0.2% (w/v) L-arabinose overnight, and E. coli EC100 carrying pBAD30 empty vector was used as control. Cloned P. asymbiotica ATCC43949 pam in pET-28α (Novagen, USA) and expressed in E. coli BL21 (DE3) (Novagen, USA) was used for the feeding assays, and compared to E. coli EC100 carrying pET-28α as control.